View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0602_high_21 (Length: 245)
Name: NF0602_high_21
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0602_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32530156 - 32530376
Alignment:
| Q |
1 |
attatctcaaactttt-atttgagcatgcctttagagtttcgttcgcagttcctaacatacaaattttatttcccaatctatcaaatttaaccctgaacc |
99 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32530156 |
attatctcaaactttttatttgagcatgcctttagagtt-cgttcgcagttctcaacatgcaaattttatttcccaatctatcaaatttaaccctgaacc |
32530254 |
T |
 |
| Q |
100 |
ggaacactatgaagcacaactgtctcaacggttaaacccggtccaaacccaaacaaaacaccccattccaacccttcaccagttgtaatctttccttcgt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
32530255 |
ggaacactatgaagcacaactgtctcaacggttaaacccggtccaaacccaaacaaaacaccccattccaacccttcaccggttgtaatctttccttcct |
32530354 |
T |
 |
| Q |
200 |
ccttagacctctttctcatttc |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32530355 |
ccttagacctctttctcatttc |
32530376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 182
Target Start/End: Original strand, 40411137 - 40411177
Alignment:
| Q |
142 |
ccaaacccaaacaaaacaccccattccaacccttcaccagt |
182 |
Q |
| |
|
|||||||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
40411137 |
ccaaaccctaagaaaacaccccactccaacccttcaccagt |
40411177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University