View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0602_low_14 (Length: 400)
Name: NF0602_low_14
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0602_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 4e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 46 - 301
Target Start/End: Original strand, 43407738 - 43407987
Alignment:
| Q |
46 |
cttcattccctttctctaatatatatcttgacatgaatgatatcttctgatctttttatataggaggatctgagaaagaactttaattataaggatggaa |
145 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43407738 |
cttcattccctttctctaatatatatcatgacatgaatgatatcttctgatctttttatataggaggatctgagaaacaactttaattataaggatggaa |
43407837 |
T |
|
| Q |
146 |
tatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgnnnnnnnnnnnnnnnnnnnnnnatcaagcagatataattgaggagctcttgg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
43407838 |
tatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtg------ggaggaggaggaggagatcaagcagatataattgaggagctgttgg |
43407931 |
T |
|
| Q |
246 |
gagaaggttgctggattgaagcaagtgagaacagtttgatgtccatgcagcaaact |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
43407932 |
gagaaggttgctggattgaagcaagtgagaatagtttgatggccatgcagcaaact |
43407987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 115 times since January 2019
Visitors: 3832