View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0602_low_16 (Length: 377)
Name: NF0602_low_16
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0602_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 312; Significance: 1e-176; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 30 - 369
Target Start/End: Complemental strand, 16684919 - 16684580
Alignment:
| Q |
30 |
gttaggaatttgatagacggtaacaatgggggagggattcttgtgtttcaagttttcgcagaatctggaagtcgaggaaggagtgaacatggatatgcaa |
129 |
Q |
| |
|
|||||||| ||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16684919 |
gttaggaacttgattgatggtaacaatgggggagggattcttgtgtttcaagttttggcagaatctggaagtcgaggaaggagtgaacctggatatgcaa |
16684820 |
T |
 |
| Q |
130 |
cttggagaccaagctcgtctagcggtgatgtgcatgttagatttgacatagggatcaatagcagtaattctgaatcagagacctcagttacttcagggag |
229 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16684819 |
cttggagaccaagctcgtctaacggtgatgtgcatgttagatttgacatagggatcaatagcagtaattctgaatcagagacctcagttacttcagggag |
16684720 |
T |
 |
| Q |
230 |
gcttgcaggaaggatgcgtacgagtgatcgggcactcgaggaaagtttgagcttcagcatttgcaagaagataatccaggtaagctatataacatttgtt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16684719 |
gcttgcaggaaggatgcgtacgagtgatcgggcactcgaggaaagtttgagcttcagcatttgcaagaagataatccaggtaagctatataacatttgtt |
16684620 |
T |
 |
| Q |
330 |
gtgtatgtctcaagagttcagttatacaccgatattcttc |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16684619 |
gtgtatgtctcaagagttcagttatacaccgattttcttc |
16684580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 94 - 187
Target Start/End: Original strand, 32790233 - 32790326
Alignment:
| Q |
94 |
ctggaagtcgaggaaggagtgaacatggatatgcaacttggagaccaagctcgtctagcggtgatgtgcatgttagatttgacatagggatcaa |
187 |
Q |
| |
|
||||||||| ||| |||| |||| | |||| ||||| |||||||||||||| |||||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
32790233 |
ctggaagtcaagggaggaatgaaaaaggatgggcaacctggagaccaagctcatctagcggtgatgtaaatattagatttgagatagggatcaa |
32790326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University