View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0602_low_21 (Length: 344)
Name: NF0602_low_21
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0602_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 237 - 339
Target Start/End: Original strand, 35745526 - 35745628
Alignment:
Q |
237 |
tataatatcaattaatagtgcctaggatatctcagatagataggtaatgctagacttccaacatcttctgcatgtcttgtctttcaatgttattcatctc |
336 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
35745526 |
tataatatcaattaatagtgcctaggatatctcagatagataggtaatgctaagcttccaacatcttctgcatgtcttgtctttcaatgttattcatgtc |
35745625 |
T |
 |
Q |
337 |
act |
339 |
Q |
|
|
||| |
|
|
T |
35745626 |
act |
35745628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 115 - 211
Target Start/End: Complemental strand, 26296643 - 26296551
Alignment:
Q |
115 |
tatctttttgaggcataattaaacgagatccgtgttgttagggtggacccaaatgctcccaaaatgacctctagtagcttccataattagaagaaag |
211 |
Q |
|
|
|||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26296643 |
tatctttttgaggcataa----acgagatctgtgttgttagggtggacccaaatgctcccaaaatgacctctagtagcttccataattagaagaaag |
26296551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 76 - 124
Target Start/End: Complemental strand, 26296874 - 26296826
Alignment:
Q |
76 |
aactggaccactagcaagagagccaatacaatgctcccatatctttttg |
124 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26296874 |
aactggaccactagcaagagagccaatacaatgctcccatatctttttg |
26296826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University