View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0602_low_23 (Length: 332)
Name: NF0602_low_23
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0602_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 13169597 - 13169351
Alignment:
| Q |
1 |
tggagcttcgagatctcgcttccgattcgtcattgattgtcgacgtt---------gatgaattgttgctggttctgcaaacaaatttcagatgttcttg |
91 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
13169597 |
tggagctacgagatctcgcttccgattcgtcattgattgtcgacgtttctttctatgatgaatggttgttggttctgcaaacaaatt-cagatgttcttc |
13169499 |
T |
|
| Q |
92 |
tttggcctcagattgtaaggccagaaatggctgctttgagacttgttgttgtagtcgaaatgatgagttgtgagtggatggatctgtatccgtgttggcg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13169498 |
tttggcctcagattgtaaggccagaaatggctgctttgagacttgttgtggt---cgaaatgatgagttgtgagtggatggatctgtatccgtgttggcg |
13169402 |
T |
|
| Q |
192 |
gtcaagtacatacaccgttcttggtatttattggaaaatgattggtgtgat |
242 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13169401 |
gtcaagttcatacaccgttcttggtatttattggaaaatgattggtgtgat |
13169351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2416 times since January 2019
Visitors: 3819