View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0602_low_25 (Length: 326)
Name: NF0602_low_25
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0602_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 44 - 192
Target Start/End: Original strand, 5664868 - 5665016
Alignment:
| Q |
44 |
ataagtctataggtgcttgaagatgttttgtggatgttgctgtaaatttttattcctggtttaatcgtgatgggtttcgatgattatatcttgtataatg |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5664868 |
ataagtctataggtgcttgaagatgttttgtggatgttgctgtaaatttttattcctagtttaatcgtgatgggtttcgatgattatatcttgtataatg |
5664967 |
T |
|
| Q |
144 |
tacatgcttttacgattgacaaaaaccattaattgtaatcctcaagaaa |
192 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5664968 |
tacatgcttttatgattgacaaaaaccattaattgtaatcctcaagaaa |
5665016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 203 - 311
Target Start/End: Original strand, 5665054 - 5665162
Alignment:
| Q |
203 |
ctattcgttgacaatgtttccttcattttccatcaaaaaatttccatcttatatttaactcattcatgtatgtaaaactaccattcccacttaaacattt |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5665054 |
ctattcgttgacaatgtttccttcgttttccatcaaaaaatttccatcttatatttaactcattcatgtatgtaaaattaccattcccacttaaacattt |
5665153 |
T |
|
| Q |
303 |
tttatgcat |
311 |
Q |
| |
|
||||||||| |
|
|
| T |
5665154 |
tttatgcat |
5665162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2469 times since January 2019
Visitors: 3819