View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0602_low_36 (Length: 275)
Name: NF0602_low_36
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0602_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 246
Target Start/End: Complemental strand, 32806215 - 32805981
Alignment:
| Q |
12 |
aagaattaaaggtgcaatatcaactaatagagaggcaccatgaaggcaattaactacagattttgcatcaagttcaacaataacattacacaattgcttt |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32806215 |
aagaattaaaggtgcaatatcaactaacagagaggcaccatgaaggcaattaactacagattctgcatcaagttcaacaataacattacacaattgcttt |
32806116 |
T |
|
| Q |
112 |
tccatagccctagcgagacaccaccgcaaacccatgcattcagctaccaaaggtgacaccgaaataccatcaaatcttgtctctgcaaacaaaaccagac |
211 |
Q |
| |
|
||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32806115 |
tccatgaccctagctaggcaccaccgcaaacccatgcattcagctaccaaaggtgacaccgaaataccatcaaatcttgtctctgcacacaaaaccagac |
32806016 |
T |
|
| Q |
212 |
ctgcagcgttgcgcacaaccatcccccaacctgtc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32806015 |
ctgcagcgttgcgcacaaccatcccccaacctgtc |
32805981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 41 - 246
Target Start/End: Original strand, 6094731 - 6094936
Alignment:
| Q |
41 |
gagaggcaccatgaaggcaattaactacagattttgcatcaagttcaacaataacattacacaattgcttttccatagccctagcgagacaccaccgcaa |
140 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6094731 |
gagaggcaccatgaaggcaattaaccacagattctgcatcaagttcaacaataacattacacaattgcttttccatggccctagcgagacaccaccgcaa |
6094830 |
T |
|
| Q |
141 |
acccatgcattcagctaccaaaggtgacaccgaaataccatcaaatcttgtctctgcaaacaaaaccagacctgcagcgttgcgcacaaccatcccccaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6094831 |
acccatgcattcagctaccaaaggtgacaccgagataccatcaaatcttgtctctgcaaacaaaaccagacctgcagcgttgcgcacaaccatcccccaa |
6094930 |
T |
|
| Q |
241 |
cctgtc |
246 |
Q |
| |
|
|||||| |
|
|
| T |
6094931 |
cctgtc |
6094936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 446 times since January 2019
Visitors: 3834