View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0602_low_37 (Length: 265)
Name: NF0602_low_37
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0602_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 20 - 236
Target Start/End: Original strand, 39294115 - 39294332
Alignment:
Q |
20 |
tttctttctaattctctagattttaaagaaaaatggtctgataatctggagttcagcaaaagataagtaaaatcggatcaataattatttcacacggaaa |
119 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||||||| | ||| |
|
|
T |
39294115 |
tttctttctaattctctagattttaaagaaaaatggtctgataatctggagttcagcaagagataaataaaatcggattaataattatttcacatgaaaa |
39294214 |
T |
 |
Q |
120 |
ctaagttcatattt-annnnnnngtagatcttattaaccactttagactgattgctttgttgagattattgttctttgttttgttgcacctttaaatttg |
218 |
Q |
|
|
||||||| |||||| || ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
39294215 |
ctaagttaatatttgtttttttggtggatcttattaatcactttagactgattgttttgttgagattattgttctttgttttgttgcacctttaaattcg |
39294314 |
T |
 |
Q |
219 |
gttattatgattaggttt |
236 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
39294315 |
gttattatgattaggttt |
39294332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 40384942 - 40384909
Alignment:
Q |
76 |
caaaagataagtaaaatcggatcaataattattt |
109 |
Q |
|
|
|||||||||||||||||| ||||||||||||||| |
|
|
T |
40384942 |
caaaagataagtaaaatctgatcaataattattt |
40384909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2459 times since January 2019
Visitors: 3819