View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0602_low_41 (Length: 233)
Name: NF0602_low_41
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0602_low_41 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 27 - 233
Target Start/End: Original strand, 38823013 - 38823219
Alignment:
Q |
27 |
cacagaaatgaaaaccatgtatatatacacacacaccacagcctcaaannnnnnnnnnnnnnnnnngacaaaacaacctcaaaattaatgttttcagcta |
126 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
38823013 |
cacagaaatgaaaaccatgtatatatacacacacaccacaacctcaaatttttttaatttttttttgacaaaacaacctcaaaattaatgttttcagcta |
38823112 |
T |
 |
Q |
127 |
ttttggaaataaaatactccctaataaatttcaaaaatcaaaaagagaactaccccttttgactcggttatgataaaaaatggaaattaagttaaaatat |
226 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
38823113 |
ttttggaaataaaatactccctaataaatttcaaaaatcaaaaagagaactaccccttttgactcggttatgataaaaaatggtaattaagttaaaatat |
38823212 |
T |
 |
Q |
227 |
ttccttt |
233 |
Q |
|
|
||||||| |
|
|
T |
38823213 |
ttccttt |
38823219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2744 times since January 2019
Visitors: 3823