View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0602_low_5 (Length: 510)
Name: NF0602_low_5
Description: NF0602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0602_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 3e-49; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 33525989 - 33525886
Alignment:
| Q |
1 |
catgtctctctagcaatgtcagttgaaataccataataatcagagtgatatctcatcactaccaaattctctttgttattgttattatcttcctccatca |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525989 |
catgtctctctagcaatatcagttgaaataccataataatcagagtgatatctcatcactaccaaattctctttgttattgttattatcttcctccatca |
33525890 |
T |
 |
| Q |
101 |
atga |
104 |
Q |
| |
|
|||| |
|
|
| T |
33525889 |
atga |
33525886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 359 - 448
Target Start/End: Complemental strand, 33525631 - 33525542
Alignment:
| Q |
359 |
gcataaccatgaaccattttgagaacacagctcttgatgattcgctgtcacgatgagtctcttctacaccaacatgatcgttataataca |
448 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525631 |
gcatcaccatgaaccattttgagaacacagctcttgatgattcgctgtcgcgatgagtctcttctacaccaacatgatcgttataataca |
33525542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 236 - 306
Target Start/End: Complemental strand, 33525754 - 33525684
Alignment:
| Q |
236 |
ccggagcagacctacatcgcatgagcaataatgcatttggaggaggcacagagatttctccatcaccacag |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525754 |
ccggagcagacctacatcgcatgagcaataatgcatttggaggaggcacagagatttctccatcaccacag |
33525684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University