View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0603_high_28 (Length: 230)
Name: NF0603_high_28
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0603_high_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 24 - 196
Target Start/End: Original strand, 17875538 - 17875710
Alignment:
| Q |
24 |
gagcacagaatcccataaaaatagtgttagagagagatagagtttgcaaacaaacacagtgtcaactctaagctgtaagctgcagaatttggatgatggg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17875538 |
gagcacagaatcccataaaaatagtgttagagagagatagaggttgcaaacaaacacagtgtcaactctaagctgtaagctgcagaatttggatgatggg |
17875637 |
T |
|
| Q |
124 |
aactcaactcggtactatttgactcactgactcattcatcattcaactcctactaaaaagtaagtaaaagggt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17875638 |
aactcaactcggtactatttgactcactgactcattcatcattcaactcctactaaaaagtaagtaaaagggt |
17875710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1227 times since January 2019
Visitors: 3841