View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0603_high_29 (Length: 225)

Name: NF0603_high_29
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0603_high_29
NF0603_high_29
[»] chr4 (1 HSPs)
chr4 (1-173)||(35762310-35762482)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 35762310 - 35762482
Alignment:
1 aattggtaatacattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattttgcagtgtatagaggccgtttctg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35762310 aattggtaatacattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattttgcagtgtatagaggccgtttctg 35762409  T
101 tgnnnnnnnaacagcataatttttgttgttgtttggtttctggtcagcctacggcgccggcctttggtggagg 173  Q
    ||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35762410 tgtttttttaacagcataatttttgttgttgtttggtttctggtcagcctacggcgccggcctttggtggagg 35762482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University