View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0603_low_10 (Length: 420)
Name: NF0603_low_10
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0603_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 103 - 343
Target Start/End: Original strand, 27608795 - 27609037
Alignment:
Q |
103 |
aatattggaatcagggaaatatcttatctagagtnnnnnnn-ttaccttcaaataaatgtcaatggctctataaagaccatcatcaatgacacgagcata |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27608795 |
aatattggaatcagggaaatatcttatctagagtaaaaaaaattaccttcaaataaatgtcaatggctctataaagaccatcatcaatgacacgagcata |
27608894 |
T |
 |
Q |
202 |
atcaggaagtatctcaatcaatgcgatgaatttctgtagacttaagcaaggatcaggagcaatctctgct-aaaaagcatcaataagctgacctactttt |
300 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
T |
27608895 |
atcaggaagtatctcaatcaatgcgatgaatttctgtagacttaagcaaggatcaggagcaatttctgctaaaaaagcatcaataagctgacctactttt |
27608994 |
T |
 |
Q |
301 |
agcagagaaccatgcccattagaaccaatcccatcggattcat |
343 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27608995 |
agcagagaaccatgcccattagaaccaatcccatcggattcat |
27609037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 70 times since January 2019
Visitors: 3832