View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0603_low_14 (Length: 370)
Name: NF0603_low_14
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0603_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 100 - 256
Target Start/End: Complemental strand, 40749726 - 40749570
Alignment:
Q |
100 |
agaaacaaacaaaaaacaatcatttgaataaaattaacacattctagctagctcataattttccctttccctcttctgaaaaaatggggatgggaactag |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40749726 |
agaaacaaacaaaaaacaatcatttgaataaaataaacacattctagctagctcataattttccctttccctcttctgaaaaaatggggatgggaactag |
40749627 |
T |
 |
Q |
200 |
cacctttgttactagatggatcaactttctcaccatggtaagtattccttttcttct |
256 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40749626 |
cacctttgttactagatggatcaactttctcaccatggtaagtattccttttcttct |
40749570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 40749825 - 40749771
Alignment:
Q |
1 |
gtgtgcgtcaccatcatcataaatattcattcatatcatataatcaaacagtaac |
55 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
40749825 |
gtgtgcgtcaccatcatcataaatattcattcatatcataacatcaaacagtaac |
40749771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University