View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0603_low_18 (Length: 322)

Name: NF0603_low_18
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0603_low_18
NF0603_low_18
[»] chr8 (2 HSPs)
chr8 (1-166)||(11531902-11532067)
chr8 (184-241)||(11532104-11532161)
[»] chr3 (2 HSPs)
chr3 (18-92)||(50495920-50495994)
chr3 (18-132)||(13615030-13615144)
[»] chr5 (1 HSPs)
chr5 (18-131)||(26300366-26300479)


Alignment Details
Target: chr8 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 11531902 - 11532067
Alignment:
1 ttcatttaagaatggtgattggataaattttagatatgttaacaaattgactgttggtggaggtggtatattgtatggtcaaggatcttctgcttggaaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
11531902 ttcatttaagaatggtgattggataaattttagatatgttaacaaattaactgttggtggaggtggtatattgtatggtcaaggatcttctgcttggaaa 11532001  T
101 actaacgattgcaaaaagaatccaaattgtcactcgctaccaattgtaagttcattttttatacaa 166  Q
    ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||    
11532002 actaacgattgcaaaaagaattcaaattgtcgctcgctaccaattgtaagttcattttttatacaa 11532067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 184 - 241
Target Start/End: Original strand, 11532104 - 11532161
Alignment:
184 ttacattttttagcaggctaatcttcgtttctaattgttcattaaaatttgatatatt 241  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||    
11532104 ttacattttttagcaggctaatcttcgttcctaattgttcattaaaattttatatatt 11532161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 18 - 92
Target Start/End: Complemental strand, 50495994 - 50495920
Alignment:
18 attggataaattttagatatgttaacaaattgactgttggtggaggtggtatattgtatggtcaaggatcttctg 92  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||| | |||| ||||||||||||||||||    
50495994 attggataaattttagatatgttaacaaattaactgttggtggaggtggcacattggatggtcaaggatcttctg 50495920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 132
Target Start/End: Original strand, 13615030 - 13615144
Alignment:
18 attggataaattttagatatgttaacaaattgactgttggtggaggtggtatattgtatggtcaaggatcttctgcttggaaaactaacgattgcaaaaa 117  Q
    ||||||| ||||| | | |||||||||| || |  ||||||||||| ||   |||| ||| ||||||| ||| ||||||||||   || |||||||||||    
13615030 attggatcaatttcaaacatgttaacaagttaatggttggtggaggaggatcattggatgctcaaggagcttatgcttggaaagtgaatgattgcaaaaa 13615129  T
118 gaatccaaattgtca 132  Q
    ||| |||||||||||    
13615130 gaacccaaattgtca 13615144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 26300366 - 26300479
Alignment:
18 attggataaattttagatatgttaacaaattgactgttggtggaggtggtatattgtatggtcaaggatcttctgcttggaaaactaacgattgcaaaaa 117  Q
    ||||||| ||||| | |||||||||||| || |  ||||||||||||||   |||| ||| ||||||| ||| |||||||||||  || |||||  ||||    
26300366 attggatcaatttcaaatatgttaacaagttaatggttggtggaggtggatcattggatgctcaaggagcttatgcttggaaaatgaatgattgtcaaaa 26300465  T
118 gaatccaaattgtc 131  Q
    ||| ||||||||||    
26300466 gaacccaaattgtc 26300479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1089 times since January 2019
Visitors: 3839