View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0603_low_19 (Length: 321)
Name: NF0603_low_19
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0603_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 224 - 307
Target Start/End: Original strand, 41291391 - 41291474
Alignment:
| Q |
224 |
accaaatattgagatataatatttttaattatagtgtcatgttaataaggatttaaaaataaaaataattggtaattttaatgt |
307 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41291391 |
accaaagattgagatataatatttttaattatagtgtcatgttaataaggatttaaaaataaaaataattggtaattttaatgt |
41291474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 16 - 90
Target Start/End: Original strand, 41291183 - 41291257
Alignment:
| Q |
16 |
atgatttcaatttttagtttagctaatggaaacattacacattattaagaaagtgtgtctcgacaaaaataaaag |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41291183 |
atgatttcaatttttagtttagctaatggaaacattacacattattaagaaagtgtgtctcgacaaaaataaaag |
41291257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 21 times since January 2019
Visitors: 3832