View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0603_low_22 (Length: 311)
Name: NF0603_low_22
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0603_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 99 - 233
Target Start/End: Original strand, 31869633 - 31869767
Alignment:
| Q |
99 |
agagagggctctcaataatggattttattttgagaatttttgcagctatgagcacacttggaagtgcattgagtatgggaacagcaaagcaaactatgcc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869633 |
agagagggctctcaataatggattttattttgagaatttttgcagctatgagcacacttggaagtgcattgagtatgggaacagcaaagcaaactatgcc |
31869732 |
T |
|
| Q |
199 |
ttttgctacacgttttgttagattcaaagtttcat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869733 |
ttttgctacacgttttgttagattcaaagtttcat |
31869767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 408 times since January 2019
Visitors: 3834