View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0603_low_23 (Length: 301)

Name: NF0603_low_23
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0603_low_23
NF0603_low_23
[»] chr2 (1 HSPs)
chr2 (189-234)||(38624899-38624944)


Alignment Details
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 234
Target Start/End: Complemental strand, 38624944 - 38624899
Alignment:
Q  189 tattaaccctattttttatttgttttgttagcaacttttctctgct 234  Q
    |||||| ||||||||||||||||||||||||||||||||| |||||    
T  38624944 tattaatcctattttttatttgttttgttagcaacttttcactgct 38624899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University