View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0603_low_26 (Length: 282)
Name: NF0603_low_26
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0603_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 3811305 - 3811071
Alignment:
| Q |
16 |
atactaaagtggtggactctagagagtgtgtttcttcaacttttggtgtctttgacaatgacaaccttcatgaccttaacgaaactatagaggaagaagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811305 |
atactaaagtggtggactctagagagtgtgtttcttcaacttttggtgtctttgacaatgacaaccttcatgaccttaacgaaactatagaggaagaagt |
3811206 |
T |
 |
| Q |
116 |
tcgtcgtagtcttagtcgtgaacgtgaacgagcagaacctgtgaagcgtgaggttatgcatgtgctgaagatgtgtttcaatggaatatagctcattaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811205 |
tcgtcgtagtcttagtcgtgaacgtgaacg---tgaagctgtgaagcgtgaggttatgcatgtgctgaagatgtgtttcaatggaatatagctcattaat |
3811109 |
T |
 |
| Q |
216 |
gtaattttcatggatattgataacttcaaccgataaca |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811108 |
gtaattttcatggatattgataacttcaaccgataaca |
3811071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 16 - 117
Target Start/End: Original strand, 27149681 - 27149782
Alignment:
| Q |
16 |
atactaaagtggtggactctagagagtgtgtttcttcaacttttggtgtctttgacaatgacaaccttcatgaccttaacgaaactatagaggaagaagt |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27149681 |
atactaatgtggtggactctagagagtgtgtttcttcaacttcttgtgtctttgacaatgacaaccttcatgaccttaacgaaactatagaggaagaagt |
27149780 |
T |
 |
| Q |
116 |
tc |
117 |
Q |
| |
|
|| |
|
|
| T |
27149781 |
tc |
27149782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 16 - 64
Target Start/End: Original strand, 8434990 - 8435038
Alignment:
| Q |
16 |
atactaaagtggtggactctagagagtgtgtttcttcaacttttggtgt |
64 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8434990 |
atactaaagtgatggactctagagagtgtgtttcttcaacttctggtgt |
8435038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University