View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0603_low_27 (Length: 282)
Name: NF0603_low_27
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0603_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 9 - 253
Target Start/End: Complemental strand, 3811312 - 3811071
Alignment:
| Q |
9 |
gaagaatatactaaagtggtggactctagagagtgtgtttcttcaacttttggtgtctttgacaatgacaaccttcatgaccttaacgaaactatagagg |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811312 |
gaagaaaatactaaagtggtggactctagagagtgtgtttcttcaacttttggtgtctttgacaatgacaaccttcatgaccttaacgaaactatagagg |
3811213 |
T |
 |
| Q |
109 |
aagaagttcgtcgtagtcttagtcgtgaacgtgaacgagcagaacctgtgaagcgtgaggttatgcatgtgctgaagatgtgtttcaatggaatatagct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811212 |
aagaagttcgtcgtagtcttagtcgtgaacgtgaacg---tgaagctgtgaagcgtgaggttatgcatgtgctgaagatgtgtttcaatggaatatagct |
3811116 |
T |
 |
| Q |
209 |
cattaatgtaattttcatggatattgataacttcaaccgataaca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811115 |
cattaatgtaattttcatggatattgataacttcaaccgataaca |
3811071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 9 - 117
Target Start/End: Original strand, 27149674 - 27149782
Alignment:
| Q |
9 |
gaagaatatactaaagtggtggactctagagagtgtgtttcttcaacttttggtgtctttgacaatgacaaccttcatgaccttaacgaaactatagagg |
108 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27149674 |
gaagaaaatactaatgtggtggactctagagagtgtgtttcttcaacttcttgtgtctttgacaatgacaaccttcatgaccttaacgaaactatagagg |
27149773 |
T |
 |
| Q |
109 |
aagaagttc |
117 |
Q |
| |
|
||||||||| |
|
|
| T |
27149774 |
aagaagttc |
27149782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 9 - 64
Target Start/End: Original strand, 8434983 - 8435038
Alignment:
| Q |
9 |
gaagaatatactaaagtggtggactctagagagtgtgtttcttcaacttttggtgt |
64 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8434983 |
gaagaaaatactaaagtgatggactctagagagtgtgtttcttcaacttctggtgt |
8435038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University