View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0603_low_35 (Length: 263)
Name: NF0603_low_35
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0603_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 42 - 240
Target Start/End: Complemental strand, 32726114 - 32725916
Alignment:
Q |
42 |
atcgactacgatatcatggaaggggtccaatgggcctcattaatccaatcacttgcttccaacaacaacggtccacatcttcggataaccgcattatcgc |
141 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32726114 |
atcgactacgatatcatggaaggggtccaatgggcctcattaatccaatcacttgcttccaacaacaacggtccacatcttcggataaccgcattatcgc |
32726015 |
T |
 |
Q |
142 |
ggacaggaaccggccggaggtcaatcgccaccgtacaagaaaccggcaggcgattaacctcctttgccgcttccctcggacaaccattttcttttcatc |
240 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32726014 |
ggacaggaaccggccggaggtcaatcgccaccgtacaagaaaccggcaggcgattaacctcctttgccgcttccctcggacaaccattttcttttcatc |
32725916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University