View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0603_low_40 (Length: 249)
Name: NF0603_low_40
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0603_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 32688018 - 32688238
Alignment:
| Q |
1 |
attttgattccaaagttaaacttaaatcttaaatnnnnnnnnnnnntgcacatcagatatcactcactgtattactggcagaaaaatccacggtaacgct |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32688018 |
attttgattccaaaattaaacttaaatcttaaatgaaaaaaaaaa-tgcacatcagatatcactcactgtattactggcagaaaaatccacagtaacgct |
32688116 |
T |
 |
| Q |
101 |
tagattnnnnnnnnnn--tcacatgcagtattacgatgttataacaaaatagttacggccaatgtatttgctcataaccctcnnnnnnnaccacaacctc |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32688117 |
tagattaaaaaaaaaaaatcacatgcagtattacgatgttataacaaaatagttacgaccaatgtatttgctcataaccctcttcttttaccacaacctc |
32688216 |
T |
 |
| Q |
199 |
ctaatgtcttacgtgagtttgt |
220 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
32688217 |
ctaatgtcttacttgagtttgt |
32688238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University