View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0603_low_41 (Length: 239)
Name: NF0603_low_41
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0603_low_41 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 239
Target Start/End: Complemental strand, 52926429 - 52926202
Alignment:
Q |
15 |
gacagagcttacgttttggataagaccaaacatcttgcaagattcaatattcacgaagctggcaacgttctcttaaagcgtggccaaggcaaactcgaga |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52926429 |
gacagagcttacgttttggataagaccaaacatcttgcaagattcaatattcacgaagctggcaacgttctcttaaagcgtggccaaggcaaactcgaga |
52926330 |
T |
 |
Q |
115 |
aacaattccgcatgaattgcatcggttgcggtctctttgtttgctatcgctctcaacaagacttcgattcttcctctttcatttatgttcttgaccaagc |
214 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52926329 |
aacaattccgcatgaattgcatcggttgcggtctctttgtttgctatcgctctcaacaagacttcgattcttcctctttcatttatgttcttgaccaagc |
52926230 |
T |
 |
Q |
215 |
cct-ag--ctgttgctgctgagaccaac |
239 |
Q |
|
|
|| || ||||||||||||| |||||| |
|
|
T |
52926229 |
actcagtactgttgctgctgaaaccaac |
52926202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University