View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0603_low_45 (Length: 225)
Name: NF0603_low_45
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0603_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 35762310 - 35762482
Alignment:
Q |
1 |
aattggtaatacattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattttgcagtgtatagaggccgtttctg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35762310 |
aattggtaatacattgtagtgtttttatccaccatagccatggttaatatgactaggttacttctctgctcgattttgcagtgtatagaggccgtttctg |
35762409 |
T |
 |
Q |
101 |
tgnnnnnnnaacagcataatttttgttgttgtttggtttctggtcagcctacggcgccggcctttggtggagg |
173 |
Q |
|
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35762410 |
tgtttttttaacagcataatttttgttgttgtttggtttctggtcagcctacggcgccggcctttggtggagg |
35762482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University