View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0603_low_49 (Length: 202)

Name: NF0603_low_49
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0603_low_49
NF0603_low_49
[»] chr6 (1 HSPs)
chr6 (1-106)||(2830498-2830603)
[»] chr5 (1 HSPs)
chr5 (28-92)||(7009702-7009766)


Alignment Details
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 2830498 - 2830603
Alignment:
1 ggtcttggaagcttgtgagttgtgactatgcagcttttgaatttattattcagaacccacgcgcttgcatttatatcaagaatcaaaatggattgatccc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2830498 ggtcttggaagcttgtgagttgtgactatgcagcttttgaatttattattcagaacccacgcgcttgcatttatatcaagaatcaaaatggattgatccc 2830597  T
101 acattt 106  Q
    ||||||    
2830598 acattt 2830603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 28 - 92
Target Start/End: Original strand, 7009702 - 7009766
Alignment:
28 atgcagcttttgaatttattattcagaacccacgcgcttgcatttatatcaagaatcaaaatgga 92  Q
    |||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||    
7009702 atgcagcttttgaatttatttttcagaacccatgtgcttgcatttatatcaagaatcaaaatgga 7009766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University