View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0603_low_49 (Length: 202)
Name: NF0603_low_49
Description: NF0603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0603_low_49 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 2830498 - 2830603
Alignment:
Q |
1 |
ggtcttggaagcttgtgagttgtgactatgcagcttttgaatttattattcagaacccacgcgcttgcatttatatcaagaatcaaaatggattgatccc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2830498 |
ggtcttggaagcttgtgagttgtgactatgcagcttttgaatttattattcagaacccacgcgcttgcatttatatcaagaatcaaaatggattgatccc |
2830597 |
T |
 |
Q |
101 |
acattt |
106 |
Q |
|
|
|||||| |
|
|
T |
2830598 |
acattt |
2830603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 28 - 92
Target Start/End: Original strand, 7009702 - 7009766
Alignment:
Q |
28 |
atgcagcttttgaatttattattcagaacccacgcgcttgcatttatatcaagaatcaaaatgga |
92 |
Q |
|
|
|||||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||| |
|
|
T |
7009702 |
atgcagcttttgaatttatttttcagaacccatgtgcttgcatttatatcaagaatcaaaatgga |
7009766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University