View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0604_high_16 (Length: 232)
Name: NF0604_high_16
Description: NF0604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0604_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 26 - 110
Target Start/End: Complemental strand, 1090721 - 1090637
Alignment:
Q |
26 |
cttcctgatttagtatatcgtaaggttaaactgtatttatcctagtctctaacatttgcattagggctacaaatatctctgctcc |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
1090721 |
cttcctgatttagtatatcgtaaggttaaactgtatttatcctagtctctaacatttgcattagggctacaaatatctttgctcc |
1090637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1036 times since January 2019
Visitors: 3839