View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0604_low_11 (Length: 369)
Name: NF0604_low_11
Description: NF0604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0604_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 2e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 99 - 344
Target Start/End: Original strand, 27903049 - 27903294
Alignment:
| Q |
99 |
caacgaaaccgcaacagttacggcggaaaccaccgtgactattccggttcttgatctccgtcttttttctcaactcgagctcaacaatatcgctgacaaa |
198 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27903049 |
caacgaaaccgcaacggttacggcggaaaccaccgtgactattccggttcttgatctccgtcttttttctcaactcgagctcaacaatatcgctgacaaa |
27903148 |
T |
 |
| Q |
199 |
aaatctaccgctcgtaaccgtcgcttcgatgacgattccattatccctaaaattgactgttacgttttcaatgagtcccggtagccggaaacaaacgtat |
298 |
Q |
| |
|
|| || || ||| |||||||| ||||||||||| ||||| ||||||||||||||||| ||| ||| | |||||||| |||||||||||||||| |||||| |
|
|
| T |
27903149 |
aactccacagcttgtaaccgttgcttcgatgacaattccgttatccctaaaattgaccgttccgtatacaatgagtgccggtagccggaaacagacgtat |
27903248 |
T |
 |
| Q |
299 |
tttcgtctccgtctccagaaaccgaactcttctgctccagttcctg |
344 |
Q |
| |
|
| ||||| |||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
27903249 |
tctcgtccccgtctccggaaaccgaactcttctgctccggttcctg |
27903294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 125 - 356
Target Start/End: Complemental strand, 33744308 - 33744075
Alignment:
| Q |
125 |
aaaccaccgtgactattccggttcttgatctccgtcttttttctcaactcgagctcaacaatatcgctgacaaaaaatctaccgctcgtaaccgtcgctt |
224 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||||||||||||||| || |
|
|
| T |
33744308 |
aaaccaccgtgactcttccggttcttgatctccgtcttttttcacaactcgagctcaacaatatcgctgacaaaaactccaccgctcgtaaccgtcgttt |
33744209 |
T |
 |
| Q |
225 |
cgatgacgattccattatccctaaaattgactgttacgttttcaat--gagtcccggtagccggaaacaaacgtattttcgtctccgtctccagaaaccg |
322 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||| |||||| ||| ||| |||||||||||||||| ||||||| |||||| ||||||| ||||||| |
|
|
| T |
33744208 |
cgatgacgattccgttatccctaaaattgaccgttccgtttttaatgagagcgccggtagccggaaacagacgtattctcgtcttcgtctccggaaaccg |
33744109 |
T |
 |
| Q |
323 |
aactcttctgctccagttcctgctcccgttgttc |
356 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
33744108 |
aactcttctgctccggttcctgctcccgttgttc |
33744075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 99 - 132
Target Start/End: Complemental strand, 33744346 - 33744313
Alignment:
| Q |
99 |
caacgaaaccgcaacagttacggcggaaaccacc |
132 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
33744346 |
caacgaaaccgcaacggttacggcggaaaccacc |
33744313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University