View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0604_low_15 (Length: 312)
Name: NF0604_low_15
Description: NF0604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0604_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 11224721 - 11224439
Alignment:
| Q |
1 |
tctgcttaccattagacgaccccttcttgcgttgctcctactaccaccaacatgtgggactttaagcttcttacgattttcggtattcttctcactttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11224721 |
tctgcttaccattagacgaccccttcttgcgttgctcctactaccaccagcatgtgggactttaagcttcttacgattttcggtattcttctcactttgt |
11224622 |
T |
|
| Q |
101 |
tgctacaattttaaactatgatagttaatacttgtatgacaaagttttttagaatatgagattgtgtaaataaatattctcaagtgtcaaagacatatta |
200 |
Q |
| |
|
| | ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11224621 |
ttcaacaattttaaactatgatagtta----ttgtatgacatagttttttagaatatgagattgtgtaaataaatattctc-ggtgtcaaagacatatta |
11224527 |
T |
|
| Q |
201 |
taagggcattttagtatctttatagattctaaaagaatgcttgtaaaataaatttctataccttcattttgtcacctttatagtgatg |
288 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11224526 |
taaggacattttagtatctttatagattctaagagaatgcttgtaaaataaatttctataccttcattttgtcacctttatagtgatg |
11224439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 187 times since January 2019
Visitors: 3831