View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0604_low_16 (Length: 266)
Name: NF0604_low_16
Description: NF0604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0604_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 238
Target Start/End: Original strand, 36606861 - 36607088
Alignment:
| Q |
11 |
tcatagggagatcattataggtaacaaatatatcattctaatggtaatgtacctgatgttttgaagtatgtgatccctggattcgttttgaagaatgaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36606861 |
tcatagggagatcattataggtaacaaatatatcattctaatggtaatgtacctgatattttgaagtatgtgatccctggattcgttttgaagaatgaag |
36606960 |
T |
 |
| Q |
111 |
ggttgcttttgaaggtgctaaggttggcacctctacattaggcttcaaaccatttacaccaaaatcggatttcggaaatttagacaaggtctctgtatta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36606961 |
ggttgcttttgaaggtgctaaggttggcacctctacattaggcttcaaaccatttacaccaaaatcggatttcggaaatttagacaaggtttctgtatta |
36607060 |
T |
 |
| Q |
211 |
attttctgtgttgatataccaccagcct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
36607061 |
attttctgtgttgatataccaccagcct |
36607088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University