View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0604_low_18 (Length: 251)
Name: NF0604_low_18
Description: NF0604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0604_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 43 - 222
Target Start/End: Original strand, 31990531 - 31990709
Alignment:
Q |
43 |
gtaggataattatccatcatcataatcgtattatgatcataaataatttattttatgttcatatttcaaatattgattatagttaaaaatgaatttgtcg |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31990531 |
gtaggataattatccatcatcataatcgtattatgatcataaataatttattttatgttcatatttcaaatattgattatagttaaaaatgaatttgtcg |
31990630 |
T |
 |
Q |
143 |
accaaattacacttgattgagggcatgtataatgaagtagttgccaaagtacccaataagtgcggttcagttggttaagc |
222 |
Q |
|
|
||||| |||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
T |
31990631 |
accaagttacacttgactgagggcatgtataatgaagtagttgcc-aagtacccaataagcgcggctcagttggttaagc |
31990709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 911 times since January 2019
Visitors: 3837