View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0605_high_11 (Length: 250)
Name: NF0605_high_11
Description: NF0605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0605_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 14 - 137
Target Start/End: Original strand, 42357333 - 42357456
Alignment:
| Q |
14 |
atatagcagtttagagtttaattttcatatattaccaaaacaatgcgcaaggaaagacacaaccacctaataactttgcgtttagttatagtttcaacca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42357333 |
atatagcagtttagagtttaattttcatatattaccaaaacaatgcgcaaggaaagacacaaccacctaacaactttgcgtttagttatagtttcaacca |
42357432 |
T |
 |
| Q |
114 |
ttattatctatcgtactagacaaa |
137 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
42357433 |
ttatcatctatcgtactagacaaa |
42357456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 210 - 248
Target Start/End: Original strand, 42357824 - 42357862
Alignment:
| Q |
210 |
tattttatcactggtattggtatatcattttttgaatta |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42357824 |
tattttatcactggtattggtatatcattttatgaatta |
42357862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 143 - 172
Target Start/End: Original strand, 42357785 - 42357814
Alignment:
| Q |
143 |
attaactgattatatactccttttaataaa |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42357785 |
attaactgattatatactccttttaataaa |
42357814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University