View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0605_low_10 (Length: 322)
Name: NF0605_low_10
Description: NF0605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0605_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 96 - 217
Target Start/End: Original strand, 50510893 - 50511014
Alignment:
Q |
96 |
acgaataacctcaccaagaagaggacaccatgatttacttgcaaaccaagaaatcaagcaaccgaataaaatacatacttgcacacctatccataacatc |
195 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50510893 |
acgaataacctcaccaagaagaggacaccatgatttacttgcaaaccaagaaatcaagcaaccgaataaaatacatacttgcacacctatccataacatc |
50510992 |
T |
 |
Q |
196 |
aattttttgttaagatattttt |
217 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
50510993 |
aattttttgttaagatattttt |
50511014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2848 times since January 2019
Visitors: 3829