View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0605_low_11 (Length: 318)
Name: NF0605_low_11
Description: NF0605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0605_low_11 |
 |  |
|
| [»] scaffold0200 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 99 - 209
Target Start/End: Complemental strand, 41975503 - 41975393
Alignment:
| Q |
99 |
aatgatagatatgtataagggacatattactggagtaatagagtttgttaatgacaattaatatgagacactaggatcttgtatttcagagttaaaagct |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
41975503 |
aatgatagatatgtataagggacatattactggagtagtagagtttgttaatgacaattaatatgagacacttggatcttgtatttgagagttaaaagct |
41975404 |
T |
 |
| Q |
199 |
aatcgtggaat |
209 |
Q |
| |
|
||||||||||| |
|
|
| T |
41975403 |
aatcgtggaat |
41975393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 214 - 294
Target Start/End: Complemental strand, 41974804 - 41974724
Alignment:
| Q |
214 |
ttttcttcgttctgcttttctgttttcgattggcaactttgttccttgcttctatgtatgttttgtctgtcttaatataac |
294 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||| |||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
41974804 |
ttttcttcgttctgcttttctgatttggattggcagctttgttcctggcttctatggatgttttgtctgtcttaatataac |
41974724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 99 - 186
Target Start/End: Original strand, 1222672 - 1222759
Alignment:
| Q |
99 |
aatgatagatatgtataagggacatattactggagtaatagagtttgttaatgacaattaatatgagacactaggatcttgtatttca |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1222672 |
aatgatagatatgtataagggacatattactggagtaatagagtttgttaatgacaattaatatgagacactaggatcttgtatttca |
1222759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 214 - 294
Target Start/End: Original strand, 1223040 - 1223120
Alignment:
| Q |
214 |
ttttcttcgttctgcttttctgttttcgattggcaactttgttccttgcttctatgtatgttttgtctgtcttaatataac |
294 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
1223040 |
ttttcttcgttctgcttttctgttttggattggcagctttgttcctgacttctatggatgttttgtctgtcttaatataac |
1223120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0200 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 214 - 294
Target Start/End: Complemental strand, 2112 - 2032
Alignment:
| Q |
214 |
ttttcttcgttctgcttttctgttttcgattggcaactttgttccttgcttctatgtatgttttgtctgtcttaatataac |
294 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||| |||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
2112 |
ttttcttcgttctgcttttctgatttggattggcagctttgttcctggcttctatggatgttttgtctgtcttaatataac |
2032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University