View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0605_low_19 (Length: 269)
Name: NF0605_low_19
Description: NF0605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0605_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 48 - 240
Target Start/End: Complemental strand, 42358226 - 42358048
Alignment:
Q |
48 |
ggttatcttttacatacactgtcagtatgctatgcttagattagatgctatatatacaattcggctctgtcgtctctgcgtgcattaatatgaatatcaa |
147 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
42358226 |
ggttatcttttacatacactgtcagtatgctatgcttagat-----gctatatatacaattcggctctgtcgtctctgcgtgcattaatatgaatatcga |
42358132 |
T |
 |
Q |
148 |
agtacacatactcatactcatactcatgcagaatagaaaagaagaaaggaaattaggattggtaattagagaagcagcgtataaagtattcat |
240 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
T |
42358131 |
agtacacatactcatac------tcatgcagaatagaaaagaagaaaggaaattaggattggga---agagaagcagcgtataaagtattcat |
42358048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2804 times since January 2019
Visitors: 3829