View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0605_low_19 (Length: 269)

Name: NF0605_low_19
Description: NF0605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0605_low_19
NF0605_low_19
[»] chr8 (1 HSPs)
chr8 (48-240)||(42358048-42358226)


Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 48 - 240
Target Start/End: Complemental strand, 42358226 - 42358048
Alignment:
48 ggttatcttttacatacactgtcagtatgctatgcttagattagatgctatatatacaattcggctctgtcgtctctgcgtgcattaatatgaatatcaa 147  Q
    |||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||| |    
42358226 ggttatcttttacatacactgtcagtatgctatgcttagat-----gctatatatacaattcggctctgtcgtctctgcgtgcattaatatgaatatcga 42358132  T
148 agtacacatactcatactcatactcatgcagaatagaaaagaagaaaggaaattaggattggtaattagagaagcagcgtataaagtattcat 240  Q
    |||||||||||||||||      ||||||||||||||||||||||||||||||||||||||| |   ||||||||||||||||||||||||||    
42358131 agtacacatactcatac------tcatgcagaatagaaaagaagaaaggaaattaggattggga---agagaagcagcgtataaagtattcat 42358048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University