View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0605_low_22 (Length: 201)
Name: NF0605_low_22
Description: NF0605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0605_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 53866111 - 53866234
Alignment:
Q |
1 |
caacttcattgttttcaaatattattattaaaaaagtatttcactttacttttcttattgaaggtcgctgatgttttcacctttgcacaatattctgtca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53866111 |
caacttcattgttttcaaatattattattaaaaaagtatttcactttacttttcttattgaaggtcgctgatgttttcacctttgcacaatattctgtca |
53866210 |
T |
 |
Q |
101 |
attgtcctttgggtccgttatatt |
124 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
53866211 |
attgtcctttgggtccgttatatt |
53866234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University