View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0605_low_6 (Length: 422)
Name: NF0605_low_6
Description: NF0605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0605_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 30 - 362
Target Start/End: Original strand, 12276095 - 12276428
Alignment:
| Q |
30 |
agtatgtgattgttgtttactcaagcatggtttgttgttcccaatcacagtgagtagttggttgtggaaccgtgatcgtgtaggcgaacgggttcaccgc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
12276095 |
agtatgtgattgttgtttactcaagcatggtttgttgttcccaatcacagtgagtagttggttttggaaccgtgattgtgttggcgaacgggttcaccgc |
12276194 |
T |
 |
| Q |
130 |
cattatgcaaagagttaagtttgtatgaatttgtctttggttcttacttgtgtatttcttgcgtcaatatttttagcaatttggtttcaggtaatgtaat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12276195 |
cattatgcaaagagttaagtttgtatgaatttgtctttggttcttacttgtgtatttcttgcgtcaatatttttagcaatttggtttcaggtaa-----t |
12276289 |
T |
 |
| Q |
230 |
taaacttaaaatcaannnnnnngcga------taagtgctagcaattgagatagaagaaggcaatggagcactgtcctgttacaaagctacaacgctgaa |
323 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12276290 |
taaacttaaaatcaatttttttgcgataattttaagtgctagcaattgagatagaagaaggcaatggagcactgtcctgttacaaagctacaacgctgaa |
12276389 |
T |
 |
| Q |
324 |
gaatttctttttggtgctagcaattgtacttatgaattt |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12276390 |
gaatttctttttggtgctagcaattgtacttatgaattt |
12276428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University