View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0605_low_8 (Length: 363)
Name: NF0605_low_8
Description: NF0605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0605_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 7 - 284
Target Start/End: Complemental strand, 36602398 - 36602121
Alignment:
| Q |
7 |
ggagcacagatgaaaagacagctggctttctatctgagttaggagttattgctcatgttgatcatcctaatactgcaaagcttgttggatgttgtgtaga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36602398 |
ggagcacagatgaaaagacagctggctttctatctgagttaggagttattgctcatgttgatcatcctaataccgcaaagcttgttggatgttgtgtaga |
36602299 |
T |
|
| Q |
107 |
gggagaaatgcatcttgtcttcgaattgtctacactgggaagtttaggatatgttcttcatggtttgtagatactttgaactctctcatgatgacaatca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602298 |
gggagaaatgcatcttgtcttcgaattgtctacactgggaagtttaggatacgttcttcatggtttgtagatactttgaactctctcatgatgacaatca |
36602199 |
T |
|
| Q |
207 |
cttttgaacttattttgtttttatatcaaatggaatgaaactcaatactcgagggtttacaaccctcgcacacatatt |
284 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602198 |
cttttaaacttattttgttttcatatcaaatggaatcaaactcaatactcgagggtttacaaccctcgcacacatatt |
36602121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 285 - 333
Target Start/End: Complemental strand, 36602086 - 36602038
Alignment:
| Q |
285 |
aacatgctttcaactttaaatgtacttatagcttattccctgatgatgt |
333 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36602086 |
aacatactttcaactttaaatgtacttatagcttattccctcatgatgt |
36602038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 32 - 124
Target Start/End: Original strand, 47014089 - 47014181
Alignment:
| Q |
32 |
ctttctatctgagttaggagttattgctcatgttgatcatcctaatactgcaaagcttgttggatgttgtgtagagggagaaatgcatcttgt |
124 |
Q |
| |
|
||||||||||||| |||| ||||||||||| | | |||||||| ||||| | ||| |||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
47014089 |
ctttctatctgagctaggcattattgctcatctaaaccatcctaacactgccagacttattggatgtggtgtagaaggagaaatgcaccttgt |
47014181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1995 times since January 2019
Visitors: 3810