View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0605_low_9 (Length: 345)
Name: NF0605_low_9
Description: NF0605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0605_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 29 - 338
Target Start/End: Complemental strand, 39809092 - 39808783
Alignment:
Q |
29 |
aatccactcattaccagccattaatctcaacctttctttgtattatatatgtaatgtaaaactactatacagtttacaatattcttaaactcaagtactc |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39809092 |
aatccactcattaccagccattaatctcaacctttctttgtattatatatgtaatgtaaaactactatacagtttacaatattcttaaactcaagtactc |
39808993 |
T |
 |
Q |
129 |
attctaatatgaagtatgtttcttgaatgttacatgatcaacatggcttatctttatgtaatgttttgtgtgcagtgttagagaaccacatgcaatgaac |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39808992 |
attctaatatgaagtatgtttcttgaatgttacatgatcaacatggcttatctttatgtaatgttttgtgtgcagtgttagagaaccacatgcaatgaac |
39808893 |
T |
 |
Q |
229 |
gatgtatattgctcatttttggttcaaatttgtgtgttgtgtattgtattgtcttttgtgttagttagttaggcaccgaatataattaacattattcctt |
328 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39808892 |
gatgtatattgctcatttttggttcaaatttgtgtgttgtgtattgtgttgtcttttgtgttagttagttaggcaccgaatataattaacattattcctt |
39808793 |
T |
 |
Q |
329 |
attcatctca |
338 |
Q |
|
|
|||| ||||| |
|
|
T |
39808792 |
attcttctca |
39808783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2599 times since January 2019
Visitors: 3822