View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0606-Insertion-2 (Length: 153)

Name: NF0606-Insertion-2
Description: NF0606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0606-Insertion-2
NF0606-Insertion-2
[»] chr5 (3 HSPs)
chr5 (11-153)||(41074344-41074486)
chr5 (54-96)||(41074094-41074136)
chr5 (107-151)||(35053571-35053615)


Alignment Details
Target: chr5 (Bit Score: 139; Significance: 4e-73; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 139; E-Value: 4e-73
Query Start/End: Original strand, 11 - 153
Target Start/End: Original strand, 41074344 - 41074486
Alignment:
11 ttatcatagcttgctttggatacacataaaacatcattaagatttaagagtgaaataagtagaattgtgagagatttaattttttctgtcacagatttac 110  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41074344 ttatcataacttgctttggatacacataaaacatcattaagatttaagagtgaaataagtagaattgtgagagatttaattttttctgtcacagatttac 41074443  T
111 tattacagtgtcatcccctcttgcatatagagttggccctgag 153  Q
    |||||||||||||||||||||||||||||||||||||||||||    
41074444 tattacagtgtcatcccctcttgcatatagagttggccctgag 41074486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 54 - 96
Target Start/End: Original strand, 41074094 - 41074136
Alignment:
54 ttaagagtgaaataagtagaattgtgagagatttaattttttc 96  Q
    |||||||||||||||||||| | ||||||||||||||||||||    
41074094 ttaagagtgaaataagtagattagtgagagatttaattttttc 41074136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 107 - 151
Target Start/End: Complemental strand, 35053615 - 35053571
Alignment:
107 ttactattacagtgtcatcccctcttgcatatagagttggccctg 151  Q
    |||||||||||||||||||| |||||||||| | |||||||||||    
35053615 ttactattacagtgtcatcctctcttgcatacaaagttggccctg 35053571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University