View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0606-Insertion-2 (Length: 153)
Name: NF0606-Insertion-2
Description: NF0606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0606-Insertion-2 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 4e-73; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 4e-73
Query Start/End: Original strand, 11 - 153
Target Start/End: Original strand, 41074344 - 41074486
Alignment:
| Q |
11 |
ttatcatagcttgctttggatacacataaaacatcattaagatttaagagtgaaataagtagaattgtgagagatttaattttttctgtcacagatttac |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41074344 |
ttatcataacttgctttggatacacataaaacatcattaagatttaagagtgaaataagtagaattgtgagagatttaattttttctgtcacagatttac |
41074443 |
T |
 |
| Q |
111 |
tattacagtgtcatcccctcttgcatatagagttggccctgag |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41074444 |
tattacagtgtcatcccctcttgcatatagagttggccctgag |
41074486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 54 - 96
Target Start/End: Original strand, 41074094 - 41074136
Alignment:
| Q |
54 |
ttaagagtgaaataagtagaattgtgagagatttaattttttc |
96 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
41074094 |
ttaagagtgaaataagtagattagtgagagatttaattttttc |
41074136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 107 - 151
Target Start/End: Complemental strand, 35053615 - 35053571
Alignment:
| Q |
107 |
ttactattacagtgtcatcccctcttgcatatagagttggccctg |
151 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | ||||||||||| |
|
|
| T |
35053615 |
ttactattacagtgtcatcctctcttgcatacaaagttggccctg |
35053571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University