View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0606-Insertion-3 (Length: 82)
Name: NF0606-Insertion-3
Description: NF0606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0606-Insertion-3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 75; Significance: 3e-35; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 3e-35
Query Start/End: Original strand, 7 - 81
Target Start/End: Original strand, 45039585 - 45039659
Alignment:
| Q |
7 |
aggttgaagctaggattctagagaaggaagttttaatcaagatttattgtggaatgcaagaagggattgtggtca |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45039585 |
aggttgaagctaggattctagagaaggaagttttaatcaagatttattgtggaatgcaagaagggattgtggtca |
45039659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 7 - 81
Target Start/End: Original strand, 29377338 - 29377412
Alignment:
| Q |
7 |
aggttgaagctaggattctagagaaggaagttttaatcaagatttattgtggaatgcaagaagggattgtggtca |
81 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||| |||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
29377338 |
aggttgaagctagggttctagggaatgaagtgttaatcaagattcattgtggcatgcaagaggggattgtggtca |
29377412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University