View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0606-Insertion-4 (Length: 76)
Name: NF0606-Insertion-4
Description: NF0606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0606-Insertion-4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 36; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 42
Target Start/End: Complemental strand, 3099749 - 3099714
Alignment:
| Q |
7 |
agatcatatatttaaaaacaaaacagtgtcttagta |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3099749 |
agatcatatatttaaaaacaaaacagtgtcttagta |
3099714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1963 times since January 2019
Visitors: 3810