View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0606_high_18 (Length: 251)
Name: NF0606_high_18
Description: NF0606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0606_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 4269423 - 4269313
Alignment:
Q |
1 |
taaaaaagagatttggttagaaccaaaattgcaatgatgcataaaatttcaaaacat-aaactcagattttaaaatgggatactaaaatcttgattcagg |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4269423 |
taaaaaagagatttggttagaaccaaaattgcaatgatgcataaaatttctaaacataaaactcagattttaaaatgggatactaaaatcttgattcagg |
4269324 |
T |
 |
Q |
100 |
tgaaatagatg |
110 |
Q |
|
|
||||||||||| |
|
|
T |
4269323 |
tgaaatagatg |
4269313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 146 - 243
Target Start/End: Complemental strand, 4269277 - 4269180
Alignment:
Q |
146 |
tgtgtaccgtgtgaaagaataacaccaaaattttactatcattgagtaaaagaatttctaaaatttaatctacataattactctttctgtttcttttc |
243 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
4269277 |
tgtgcaccgtgtgaaagaataacaccaaaattttactatcattgagtaaaagaatttctaaaatttaatctacataattactctttctttttcttttc |
4269180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1043 times since January 2019
Visitors: 3839