View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0606_high_21 (Length: 213)
Name: NF0606_high_21
Description: NF0606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0606_high_21 |
 |  |
|
[»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 102 - 213
Target Start/End: Complemental strand, 23991322 - 23991211
Alignment:
Q |
102 |
tcagtatgttgcttctttggaactggagtggaagcttgttcaactaattgtgtcgatggtttaccatccaaacgcctcccgataccactgaatggcatca |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23991322 |
tcagtatgttgcttctttggaactggagtggaagcttgttcaactaattgtgtcgacggtttaccatccaaacgcctcccgataccactgaatggcatca |
23991223 |
T |
 |
Q |
202 |
gtcttggaacct |
213 |
Q |
|
|
|||||||||||| |
|
|
T |
23991222 |
gtcttggaacct |
23991211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 98 - 209
Target Start/End: Complemental strand, 23984662 - 23984551
Alignment:
Q |
98 |
attttcagtatgttgcttctttggaactggagtggaagcttgttcaactaattgtgtcgatggtttaccatccaaacgcctcccgataccactgaatggc |
197 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23984662 |
attttcagtatgttgcttctttggaactggagtggaagcttgttcaactgattgtgtcgacggtttaccatccaaacgcctcccgataccactgaatggc |
23984563 |
T |
 |
Q |
198 |
atcagtcttgga |
209 |
Q |
|
|
|||||||||||| |
|
|
T |
23984562 |
atcagtcttgga |
23984551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 98 - 178
Target Start/End: Complemental strand, 23967734 - 23967654
Alignment:
Q |
98 |
attttcagtatgttgcttctttggaactggagtggaagcttgttcaactaattgtgtcgatggtttaccatccaaacgcct |
178 |
Q |
|
|
||||||||| ||||||| |||| || |||||| |||| |||||| | | |||||| ||| |||||||||||||||||||| |
|
|
T |
23967734 |
attttcagtttgttgctgctttataattggagtagaagtttgttcgattgattgtgccgacggtttaccatccaaacgcct |
23967654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University