View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0606_high_25 (Length: 201)
Name: NF0606_high_25
Description: NF0606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0606_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 32274642 - 32274519
Alignment:
| Q |
1 |
aacagatttttacttagggcctttaatttgtgactttcttattgtcactgtgataataaaacatannnnnnncccttctatcttagcatttcataa-ttc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||| ||| |
|
|
| T |
32274642 |
aacagatttttacttagggcctttaatttgtgactatcttattgtcactgtgataataaaacagattttaatcccttctatcttagcatttcataatttc |
32274543 |
T |
 |
| Q |
100 |
cactttattcttactctatctctg |
123 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
32274542 |
cactttattcttactctatttctg |
32274519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University