View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0606_low_24 (Length: 297)
Name: NF0606_low_24
Description: NF0606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0606_low_24 |
 | |
|
| [»] scaffold0013 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 30 - 288
Target Start/End: Complemental strand, 10795913 - 10795655
Alignment:
| Q |
30 |
ctgacaatctttgctttaacttgtactctgatgtaacttcatctagtttctttattatgtaagaatttgttaaccatcttattcagtttgttactttatc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10795913 |
ctgacaatctttgctttaacttgtactctgatgtaacttcatctagtttctttattatgtaagaatttgttaaccatcttattcagtttgttactttatc |
10795814 |
T |
|
| Q |
130 |
ttaggtaacaggcattgtaacaggttttgtactagtttggtttcctgctccaactgtttctcttaaacctcctcctgcaattagtgctggaattattgcc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10795813 |
ttaggtaacaggcattgtaacaggttttgtactagtttggtttcctgctccaactgtttctcttaaacctcctcctgcaattagtgctggaattattgcc |
10795714 |
T |
|
| Q |
230 |
aaattcttctatggatgtcctgaaaatgcttttcaggttaagacactctagctctctgc |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10795713 |
aaattcttctatggatgtcctgaaaatgcttttcaggttaagacactctagctttctgc |
10795655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 142 - 270
Target Start/End: Complemental strand, 58043 - 57915
Alignment:
| Q |
142 |
cattgtaacaggttttgtactagtttggtttcctgctccaactgtttctcttaaacctcctcctgcaattagtgctggaattattgccaaattcttctat |
241 |
Q |
| |
|
||||||| ||| |||| | || || ||| |||||||||| || ||||||||| ||| || ||| | | ||||||||| ||||||| |||||||||| |
|
|
| T |
58043 |
cattgtagcagattttatgcttgtgtggcttcctgctccgaccgtttctcttcgaccaccaccttccgtcagtgctggacttattgctaaattcttcttc |
57944 |
T |
|
| Q |
242 |
ggatgtcctgaaaatgcttttcaggttaa |
270 |
Q |
| |
|
|| || ||||||||||||||||||||||| |
|
|
| T |
57943 |
ggctgccctgaaaatgcttttcaggttaa |
57915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2493 times since January 2019
Visitors: 3819