View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0606_low_28 (Length: 251)

Name: NF0606_low_28
Description: NF0606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0606_low_28
NF0606_low_28
[»] chr5 (2 HSPs)
chr5 (1-110)||(4269313-4269423)
chr5 (146-243)||(4269180-4269277)


Alignment Details
Target: chr5 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 4269423 - 4269313
Alignment:
1 taaaaaagagatttggttagaaccaaaattgcaatgatgcataaaatttcaaaacat-aaactcagattttaaaatgggatactaaaatcttgattcagg 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||    
4269423 taaaaaagagatttggttagaaccaaaattgcaatgatgcataaaatttctaaacataaaactcagattttaaaatgggatactaaaatcttgattcagg 4269324  T
100 tgaaatagatg 110  Q
    |||||||||||    
4269323 tgaaatagatg 4269313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 146 - 243
Target Start/End: Complemental strand, 4269277 - 4269180
Alignment:
146 tgtgtaccgtgtgaaagaataacaccaaaattttactatcattgagtaaaagaatttctaaaatttaatctacataattactctttctgtttcttttc 243  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
4269277 tgtgcaccgtgtgaaagaataacaccaaaattttactatcattgagtaaaagaatttctaaaatttaatctacataattactctttctttttcttttc 4269180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University