View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0606_low_32 (Length: 212)
Name: NF0606_low_32
Description: NF0606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0606_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 2665208 - 2665344
Alignment:
| Q |
1 |
tgagcctccggttattccaacattccccccattggatgtagctgctccttcttactcatcattgccactgcgccccgcttacatctctagaagattgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2665208 |
tgagcctccggttattccaacattccccccattggatgtagctgctccttcttactcatcattgccactgcgccccacttacatctctagaagattgatg |
2665307 |
T |
|
| Q |
101 |
gctgttcacttttaagtctcttgcaattgagcctatg |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2665308 |
gctgttcacttttaagtctcttgcaattgagcctatg |
2665344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2411 times since January 2019
Visitors: 3819