View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0606_low_35 (Length: 205)

Name: NF0606_low_35
Description: NF0606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0606_low_35
NF0606_low_35
[»] chr2 (3 HSPs)
chr2 (1-124)||(45039455-45039578)
chr2 (1-120)||(45065371-45065490)
chr2 (18-124)||(45083029-45083135)
[»] chr8 (1 HSPs)
chr8 (1-112)||(29377220-29377331)


Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 45039578 - 45039455
Alignment:
1 gtgattcatttctcccgtaacattcttcagtgttcatttcaccgattgcaatgtctttgtcaattaaaacacgagatcttgttatggtgctcaatgatcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45039578 gtgattcatttctcccgtaacattcttcagtgttcatttcaccgattgcaatgtctttgtcaattaaaacacgagatcttgttatggtgctcaatgatcc 45039479  T
101 tgcatctttcttcttaatgtcttc 124  Q
    ||||||||||||||||||||||||    
45039478 tgcatctttcttcttaatgtcttc 45039455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 45065490 - 45065371
Alignment:
1 gtgattcatttctcccgtaacattcttcagtgttcatttcaccgattgcaatgtctttgtcaattaaaacacgagatcttgttatggtgctcaatgatcc 100  Q
    |||||| |||||  || |||||||||||||||||||||||||| || | | |||||||||||||||  ||| | |||||||||||| |||||| ||||||    
45065490 gtgatttatttcggccataacattcttcagtgttcatttcacctatcgtagtgtctttgtcaattagtacatgggatcttgttatgttgctcattgatcc 45065391  T
101 tgcatctttcttcttaatgt 120  Q
    ||||||||||||||||||||    
45065390 tgcatctttcttcttaatgt 45065371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 18 - 124
Target Start/End: Original strand, 45083029 - 45083135
Alignment:
18 taacattcttcagtgttcatttcaccgattgcaatgtctttgtcaattaaaacacgagatcttgttatggtgctcaatgatcctgcatctttcttcttaa 117  Q
    |||||||||| ||||||||||||||| |||||| |||| ||||||   |  | | ||||||||||||||||| |||||||||| ||| |||||||||| |    
45083029 taacattctttagtgttcatttcacccattgcagtgtcattgtcatcaaggagatgagatcttgttatggtgatcaatgatcccgcacctttcttcttga 45083128  T
118 tgtcttc 124  Q
    |||||||    
45083129 tgtcttc 45083135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 29377331 - 29377220
Alignment:
1 gtgattcatttctcccgtaacattcttcagtgttcatttcaccgattgcaatgtctttgtcaattaaaacacgagatcttgttatggtgctcaatgatcc 100  Q
    |||||||||||| |||||||||||||||||| ||||||||| | |||||| |||||||||||||||| | | | ||||||||||||||||||| ||| ||    
29377331 gtgattcatttcgcccgtaacattcttcagttttcatttcatctattgcagtgtctttgtcaattaagatatgggatcttgttatggtgctcactgaccc 29377232  T
101 tgcatctttctt 112  Q
    ||  ||||||||    
29377231 tgtgtctttctt 29377220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University