View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0606_low_35 (Length: 205)
Name: NF0606_low_35
Description: NF0606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0606_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 45039578 - 45039455
Alignment:
| Q |
1 |
gtgattcatttctcccgtaacattcttcagtgttcatttcaccgattgcaatgtctttgtcaattaaaacacgagatcttgttatggtgctcaatgatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45039578 |
gtgattcatttctcccgtaacattcttcagtgttcatttcaccgattgcaatgtctttgtcaattaaaacacgagatcttgttatggtgctcaatgatcc |
45039479 |
T |
 |
| Q |
101 |
tgcatctttcttcttaatgtcttc |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45039478 |
tgcatctttcttcttaatgtcttc |
45039455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 45065490 - 45065371
Alignment:
| Q |
1 |
gtgattcatttctcccgtaacattcttcagtgttcatttcaccgattgcaatgtctttgtcaattaaaacacgagatcttgttatggtgctcaatgatcc |
100 |
Q |
| |
|
|||||| ||||| || |||||||||||||||||||||||||| || | | ||||||||||||||| ||| | |||||||||||| |||||| |||||| |
|
|
| T |
45065490 |
gtgatttatttcggccataacattcttcagtgttcatttcacctatcgtagtgtctttgtcaattagtacatgggatcttgttatgttgctcattgatcc |
45065391 |
T |
 |
| Q |
101 |
tgcatctttcttcttaatgt |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45065390 |
tgcatctttcttcttaatgt |
45065371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 18 - 124
Target Start/End: Original strand, 45083029 - 45083135
Alignment:
| Q |
18 |
taacattcttcagtgttcatttcaccgattgcaatgtctttgtcaattaaaacacgagatcttgttatggtgctcaatgatcctgcatctttcttcttaa |
117 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||| |||| |||||| | | | ||||||||||||||||| |||||||||| ||| |||||||||| | |
|
|
| T |
45083029 |
taacattctttagtgttcatttcacccattgcagtgtcattgtcatcaaggagatgagatcttgttatggtgatcaatgatcccgcacctttcttcttga |
45083128 |
T |
 |
| Q |
118 |
tgtcttc |
124 |
Q |
| |
|
||||||| |
|
|
| T |
45083129 |
tgtcttc |
45083135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 29377331 - 29377220
Alignment:
| Q |
1 |
gtgattcatttctcccgtaacattcttcagtgttcatttcaccgattgcaatgtctttgtcaattaaaacacgagatcttgttatggtgctcaatgatcc |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||| | |||||| |||||||||||||||| | | | ||||||||||||||||||| ||| || |
|
|
| T |
29377331 |
gtgattcatttcgcccgtaacattcttcagttttcatttcatctattgcagtgtctttgtcaattaagatatgggatcttgttatggtgctcactgaccc |
29377232 |
T |
 |
| Q |
101 |
tgcatctttctt |
112 |
Q |
| |
|
|| |||||||| |
|
|
| T |
29377231 |
tgtgtctttctt |
29377220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University