View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0607_high_15 (Length: 201)
Name: NF0607_high_15
Description: NF0607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0607_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 42677033 - 42677137
Alignment:
Q |
1 |
atgacaaacttggagaccactctaagcaatatatagcgtctttcctccactttccctgtcattagtcattactaatatcgatcacactttggtgatcgtg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42677033 |
atgacaaacttggagaccactctaagcaatatatagcgtctttcctccactttccctgtcattagtcattactaatatcgatcacactttggtgatcgtg |
42677132 |
T |
 |
Q |
101 |
ctcct |
105 |
Q |
|
|
||||| |
|
|
T |
42677133 |
ctcct |
42677137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1071 times since January 2019
Visitors: 3839