View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0607_high_7 (Length: 270)
Name: NF0607_high_7
Description: NF0607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0607_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 23 - 268
Target Start/End: Original strand, 30477919 - 30478159
Alignment:
| Q |
23 |
gagagaaaa-gaagcatatcggaagttttatatatgattggcattaattaaattctaggaaatatttttgatactta----gattttgttggatatggta |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30477919 |
gagagaaaatgaagcatatcggaagttttatatatgattggcattaa----attctaggaaatatttttgatacttaattagattttgttggatatggta |
30478014 |
T |
|
| Q |
118 |
ctatgtagttaaaattaattttaaattttaaattctttttggtgatgatcgaactcaaaacctcgtacacattaacactaaatcattg-acataaagcca |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30478015 |
ctatgtagttaaaattaatt-------ttaaattctttttggtgatgatcgaactcaaaacctcgtacacattaacactaaatcattgaacataaagcca |
30478107 |
T |
|
| Q |
217 |
agtattgcgaccaccaagaatcgaaccctaggtaaacacagtggcgcaatgt |
268 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
30478108 |
agtattgcgaccaccaaaaatcgaaccctaggtaaacatagtggcgcgatgt |
30478159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 804 times since January 2019
Visitors: 3837